All products have special prices for bulk purchase, please contact for more details if required.

Explore Versatile Options with Our Glycerol-Free and Lyophilized Variants

Delight in the flexibility of our product offerings, now available in a glycerol-free version, meticulously crafted to seamlessly integrate with your freeze-drying systems. 

Additionally, we present a lyophilized version, a practical solution ensuring stable transportation at room temperature, thereby notably mitigating shipping costs, especially during long-distance transits.

We also offer DNA-free Taq DNA Polymerase, which has undergone a rigorous E. coli DNA removal process.

Cat. No.: EUT-500 (for 500U, sample)

Cat. No.: EUT-200k (for 200KU)

The lyophilized U-Taq DNA Polymerase is also available by inquiry, which can be transported at room temperature.

For the glycerol-free version, please visit U-Taq DNA Polymerase (Glycerol Free).

Description

U-Taq DNA Polymerase is a robust thermostable Taq enzyme that consists of a single polypeptide with a molecular weight of 94 kDa. It has a 5'→3' DNA polymerase activity and lacks 3'→5' exonuclease activity. Its extension rate is 2~4 kb/min in standard conditions, which is the highest among all thermostable DNA enzymes. The appropriate reaction temperature is 70~75℃, the work concentration of dNTPs is 100~300 μM, the work concentration of Mg²⁺ is 2~3 mM, and the suitable pH is 8.1~9.1. The enzyme generates PCR products with 3'-dA overhangs, suitable for T-A cloning. The amount of enzyme is 1~1.5 units for 20μl PCR reaction, while 2~3 units for 50μl PCR reaction. 6 kb Lambda DNA and 2.1 kb Human genomic DNA can be amplified very well at our laboratory.

Components

500U

• U-Taq DNA Polymerase Storage Buffer: U-Taq DNA Polymerase is supplied in 50 mM Tris-HCl (pH8.0), 100 mM NaCl, 0.1 mM EDTA,0.5 mM DTT, 1% TritonX-100, and 50% Glycerol. 
• 10 x U-Taq reaction buffer: 500 mM KCI, 100 mM Tris-HCI (pH8.0), 20 mM MgCI₂.

Note: All product outward appearance, the size color take the material object as. The picture only supplies the reference.

Instruction: Protocol

Related: U-Taq DNA Polymerase (Glycerol Free), 2 x Taq PCR MasterMix, Pfu DNA Polymerase, Taq Monoclonal Antibody

SBS Genetech is recognized as one of the global major leading industry players in DNA Polymerase by third-party market researchers. For more details, please visit DNA Polymerase Market Size To Reach USD 568.3 Million In 2030 | Rising Demand For Customized DNA Polymerase And Next-Generation DNA Sequencing Are Some Of The Key Factors Driving Market Revenue Growth, Says Reports and Data

Featured Citations

Interested in seeing published research using our U-Taq DNA Polymerase?

Pseudomonas spp. associated with tomato pith necrosis in the Salto area, Northwest Uruguay

^{_{European Journal of Plant Pathology    |     19 Jan 2023    |    DOI: https://doi.org/10.1007/s10658-023-02639-6}}

^{_{The PCR reactions contained 1X PCR buffer, 2.5 mM MgCl2, 0.4 mM of each dNTP, 0.4 μM of each primer, 1 U Taq polymerase (SBS Genetech Co., Ltd., China), and 1 μL of template DNA (100 ng μl−1). The PCR reaction was adjusted to a final volume of 25 μl with MQ water.}}

Sequencing of Norovirus in Southern, Nigeria: Prevalent Genotypes and Putative GII.4 Novel Recombinants among Children

^{_{Genetic Variation    |    16 Dec 2020    |    DOI: https://doi.org/10.5772/intechopen.94389}}

^{_{The RT-PCR used is a very sensitive method, it can detect as few as 5 x 106 copies per gram of stool sample. U-TaQ DNA polymerase (SBS genetech, Beijing, China), a high-fidelity thermostable enzyme that can withstand prolonged incubation at high temperature up to 95°C without significant loss of activity was used for this RT-PCR protocol.}}

Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia

^{_{Journal of Applied Hematology    |    17 Nov 2020    |    DOI: https://doi.org/10.4103/joah.joah_41_20}}

^{_{Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.}}

Expression, purification and initial characterization of human serum albumin domain I and its cysteine 34

^{_{PLOS ONE    |    12 Oct 2020    |    DOI: https://doi.org/10.1007/s10658-023-02639-6}}

^{_{Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech)}}

Evaluation of Nested broad-range PCR for Pathogen Detection in Negative Blood Cultures

^{_{JOURNAL OF CLINICAL RESEARCH AND APPLIED MEDICINE   |    6 Oct 2020    |    DOI: https://doi.org/10.5530/jcram.2.2.11}}

^{_{Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.}}

Identificación por catálogo y detección molecular de bovinos Holstein portadores de braquiespina en Uruguay

^{_{Revista FAVE. Sección Ciencias veterinarias   |    1 Aug 2020    |    DOI: https://doi.org/10.14409/favecv.v19i2.9523}}

^{_{La reacción fue puesta a punto en un volumen final de 25µL conteniendo: 100ng de ADN genómico, 2.5µL de Buffer de PCR 10X (Mg2+: 20mM), 1µM de cada primer, 10mM dNTPs y 0.4µL U-Taq ADN polimerasa (SBS Genetech Co., Ltd., China).}}

Only for research and not intended for treatment of humans or animals

Journals Using SBS Genetech Products                                       Universities Using SBS Genetech Products

SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory