![Taq-D DNA Polymerase](https://custom-images.strikinglycdn.com/res/hrscywv4p/image/upload/c_limit,fl_lossy,h_1000,w_500,f_auto,q_auto/2311560/448303_189607.png)
Taq-D DNA Polymerase
$87.00 - $2,600.00
All products have special prices for bulk purchase, please contact for more details if required.
Cat. No.: EDUT-500 (for 500U)
Cat. No.: EDUT-2500 (for 500U×5)
Cat. No.: EDUT-10KU (for 2500U×4)
Cat. No.: EDUT-25KU (for 2500U×10)
The lyophilized Taq-D DNA Polymerase is also available by inquiry, which can be transported at room temperature.
We also offer DNA-Free Taq-D DNA Polymerase, which has undergone a rigorous E. coli DNA removal process.
Description
Taq-D DNA Polymerase is a direct-acting Taq DNA polymerase, which is a modified form of Taq DNA polymerase derived from the thermophilic bacterium Thermus aquaticus, recombinantly expressed in Escherichia coli. This enzyme has been genetically engineered and is particularly suitable for amplifying samples containing PCR inhibitors, such as blood. It can amplify DNA fragments up to 3 kb in length. The extension rate is 1.0 kb/min at 72°C. This enzyme exhibits 5'→3' polymerase activity, without 5'→3' exonuclease activity or 3'→5' exonuclease activity. The amplified products have 3'-dA tails. This enzyme is not suitable for Taqman probe-based q-PCR. It is particularly well-suited for single nucleotide polymorphism (SNP) genotyping using the melting curve method.
Activity Definition
The enzyme activity is defined as the amount of enzyme required to incorporate 10 nmol of deoxyribonucleotides into acid-insoluble material at 72°C for 30 minutes, using Mahi Mahi sperm DNA as a template/primer, and is expressed as one unit (U).
Concentration
5 U/μl
Features
- No exonuclease activity, suitable for single nucleotide polymorphism (SNP) genotyping using the melting curve method.
- Excellent heat stability: Half-life exceeds 40 minutes at 95°C.
- Can incorporate dUTP, dITP, and fluorescently labeled nucleotides.
- Compared to regular Taq DNA polymerase, this enzyme is more suitable for PCR with untreated blood, tissue, saliva, and other samples.
Applications
- Melting curve-based gene typing/SNP analysis.
- Direct PCR with blood, tissue samples, and more.
- DNA fluorescent labeling.
- Colony PCR.
- Addition of 3’-dA to TA cloning PCR products.
Note: All product outward appearance, the size color take the material object as. The picture only supplies the reference.
Instruction: Protocol
Related: U-Taq DNA Polymerase (Glycerol Free), 2 x Taq PCR MasterMix, Pfu DNA Polymerase, Taq Monoclonal Antibody
SBS Genetech is recognized as one of the global major leading industry players in DNA Polymerase by third-party market researchers. For more details, please visit DNA Polymerase Market Size To Reach USD 568.3 Million In 2030 | Rising Demand For Customized DNA Polymerase And Next-Generation DNA Sequencing Are Some Of The Key Factors Driving Market Revenue Growth, Says Reports and Data
Featured Citations
Interested in seeing published research using our U-Taq DNA Polymerase?
Pseudomonas spp. associated with tomato pith necrosis in the Salto area, Northwest Uruguay
European Journal of Plant Pathology | 19 Jan 2023 | DOI: https://doi.org/10.1007/s10658-023-02639-6
The PCR reactions contained 1X PCR buffer, 2.5 mM MgCl2, 0.4 mM of each dNTP, 0.4 μM of each primer, 1 U Taq polymerase (SBS Genetech Co., Ltd., China), and 1 μL of template DNA (100 ng μl−1). The PCR reaction was adjusted to a final volume of 25 μl with MQ water.
Sequencing of Norovirus in Southern, Nigeria: Prevalent Genotypes and Putative GII.4 Novel Recombinants among Children
Genetic Variation | 16 Dec 2020 | DOI: https://doi.org/10.5772/intechopen.94389
The RT-PCR used is a very sensitive method, it can detect as few as 5 x 106 copies per gram of stool sample. U-TaQ DNA polymerase (SBS genetech, Beijing, China), a high-fidelity thermostable enzyme that can withstand prolonged incubation at high temperature up to 95°C without significant loss of activity was used for this RT-PCR protocol.
Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia
Journal of Applied Hematology | 17 Nov 2020 | DOI: https://doi.org/10.4103/joah.joah_41_20
Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.
Expression, purification and initial characterization of human serum albumin domain I and its cysteine 34
PLOS ONE | 12 Oct 2020 | DOI: https://doi.org/10.1007/s10658-023-02639-6
Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech)
Evaluation of Nested broad-range PCR for Pathogen Detection in Negative Blood Cultures
JOURNAL OF CLINICAL RESEARCH AND APPLIED MEDICINE | 6 Oct 2020 | DOI: https://doi.org/10.5530/jcram.2.2.11
Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.
Identificación por catálogo y detección molecular de bovinos Holstein portadores de braquiespina en Uruguay
Revista FAVE. Sección Ciencias veterinarias | 1 Aug 2020 | DOI: https://doi.org/10.14409/favecv.v19i2.9523
La reacción fue puesta a punto en un volumen final de 25µL conteniendo: 100ng de ADN genómico, 2.5µL de Buffer de PCR 10X (Mg2+: 20mM), 1µM de cada primer, 10mM dNTPs y 0.4µL U-Taq ADN polimerasa (SBS Genetech Co., Ltd., China).
Only for research and not intended for treatment of humans or animals
Journals Using SBS Genetech Products Universities Using SBS Genetech Products
SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory