
HY High-Yield T7 RNA Synthesis Kit
$510.00 - $850.00
$1,000.00
All products have special prices for bulk purchase, please contact for more details if required.
Cat. No.: HYT7SK-25 (for 25T)
Cat. No.: HYT7SK-50 (for 50T)
Description
HY High-Yield T7 RNA Synthesis Kit has been newly upgraded, now achieving a remarkable yield of 7.5-10 mg/ml! This highly efficient in vitro kit allows for the synthesis of various types of RNA, such as mRNA, lncRNA, shRNA, and more. By utilizing the High-Yield T7 RNA polymerase, which recognizes the T7 promoter sequence TTCTAATACGACTCACTATAG (with the G base in the box serving as the transcription start site), this kit enables efficient transcription from small sample amounts. A single reaction can yield up to 150-200 μg of products, with transcript lengths reaching over 4000 nt.
The RNA obtained from the HY High-Yield T7 RNA Synthesis Kit is well-suited for a wide range of downstream applications, including RNA structure and functional studies, nucleic acid enzyme biochemistry research, RNase protection analysis probes, Northern blotting, antisense RNA and RNAi experiments, microarray analysis, microinjection, in vitro translation, RNA vaccines, and more.
HY High-Yield T7 RNA Synthesis Kit offers user-friendly convenience, with optimized premixes that allow for quick reaction setup. Additionally, the kit is equipped with DNase I, facilitating the rapid removal of DNA templates after RNA synthesis and enabling the obtainment of highly pure transcribed RNA.
Storage
The minimum shelf life is 2 years at -20°C. Avoid repeated freeze-thaw cycles.
Instruction: Protocol
Related: Prime T7 RNA Polymerase
SBS Genetech is recognized as one of the global major leading industry players in mRNA Raw Material by third-party market researchers. For more details, please visit Top 5 mRNA Vaccine & Therapeutics Raw Material Market Companies in Global Market 2022.
Only for research and not intended for treatment of humans or animals
Journals Using SBS Genetech Products Universities Using SBS Genetech Products
SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory